based genetic algorithm objective tool box Search Results


taq man based rtpcr probes  (Transnetyx)
99
Transnetyx taq man based rtpcr probes
Taq Man Based Rtpcr Probes, supplied by Transnetyx, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taq man based rtpcr probes/product/Transnetyx
Average 99 stars, based on 1 article reviews
taq man based rtpcr probes - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
silico prediction tools  (Sophia Genetics)
97
Sophia Genetics silico prediction tools
Silico Prediction Tools, supplied by Sophia Genetics, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/silico prediction tools/product/Sophia Genetics
Average 97 stars, based on 1 article reviews
silico prediction tools - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier
arlequin population genetics software package  (PopulationGenetics)
90
PopulationGenetics arlequin population genetics software package
Arlequin Population Genetics Software Package, supplied by PopulationGenetics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/arlequin population genetics software package/product/PopulationGenetics
Average 90 stars, based on 1 article reviews
arlequin population genetics software package - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
geneexpress software system release 1.4.2  (Gene Logic Inc)
90
Gene Logic Inc geneexpress software system release 1.4.2
Geneexpress Software System Release 1.4.2, supplied by Gene Logic Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/geneexpress software system release 1.4.2/product/Gene Logic Inc
Average 90 stars, based on 1 article reviews
geneexpress software system release 1.4.2 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
amo 5’-agaaaagcgggcgatgttaccttca-3  (Gene Tools Inc)
90
Gene Tools Inc amo 5’-agaaaagcgggcgatgttaccttca-3
Amo 5’ Agaaaagcgggcgatgttaccttca 3, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/amo 5’-agaaaagcgggcgatgttaccttca-3/product/Gene Tools Inc
Average 90 stars, based on 1 article reviews
amo 5’-agaaaagcgggcgatgttaccttca-3 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
access 1.7 software  (BioNano Genomics)
90
BioNano Genomics access 1.7 software
Access 1.7 Software, supplied by BioNano Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/access 1.7 software/product/BioNano Genomics
Average 90 stars, based on 1 article reviews
access 1.7 software - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
human genetics amplifier  (Knowledge Portal Network)
90
Knowledge Portal Network human genetics amplifier
Human Genetics Amplifier, supplied by Knowledge Portal Network, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human genetics amplifier/product/Knowledge Portal Network
Average 90 stars, based on 1 article reviews
human genetics amplifier - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
dna sequencer  (Thermo Fisher)
99
Thermo Fisher dna sequencer
Dna Sequencer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna sequencer/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
dna sequencer - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
sequencebased reagent standard control morpholino  (Gene Tools Inc)
90
Gene Tools Inc sequencebased reagent standard control morpholino
Sequencebased Reagent Standard Control Morpholino, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequencebased reagent standard control morpholino/product/Gene Tools Inc
Average 90 stars, based on 1 article reviews
sequencebased reagent standard control morpholino - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
gene analysis exdega tool  (Ebiogen Inc)
86
Ebiogen Inc gene analysis exdega tool
Gene Analysis Exdega Tool, supplied by Ebiogen Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene analysis exdega tool/product/Ebiogen Inc
Average 86 stars, based on 1 article reviews
gene analysis exdega tool - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier
5-base c1qr mismatch mo (gtcagtctgatagtactcggtttag)  (Gene Tools Inc)
90
Gene Tools Inc 5-base c1qr mismatch mo (gtcagtctgatagtactcggtttag)
Clec14a and <t>C1qr</t> have a partially redundant function during angiogenic sprouting. Kdrl: GFP expression in the trunk region imaged by fluorescent microscopy at 28 hpf ( a - d ), 48 hpf ( e - h ) and 72 hpf ( i - l ). a , e , i Wild-type control embryos; b , f , j clec14a−/− mutants; c , g , k Wild-type embryos injected with 10 ng of c1qr MO; d , h , l clec14a−/− mutant embryos injected with 10 ng of c1qr MO. Note the delayed intersegmental vessel sprouting in clec14a mutants ( b ) and c1qr MO embryos ( c ) at 24 hpf (arrowheads). Partial sprouts (arrowheads) and abnormal vascular connections (arrows) are apparent in the clec14a−/−; c1qr MO embryos ( d , h , l ). m Percentage of embryos with vascular defects. ** p < 0.01; *** p < 0.001; NS, no significance, Fisher’s exact test. Data were combined from 3 independent experiments. Error bars show standard error. n Distribution of different types of phenotypes in embryos at 48 hpf. Data were combined from two independent experiments
5 Base C1qr Mismatch Mo (Gtcagtctgatagtactcggtttag), supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/5-base c1qr mismatch mo (gtcagtctgatagtactcggtttag)/product/Gene Tools Inc
Average 90 stars, based on 1 article reviews
5-base c1qr mismatch mo (gtcagtctgatagtactcggtttag) - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier
sense control morpholino oligonucleotide (co-mo) composed of base sequence 5′-ccagaatgctttccaaactaatcca-3′  (Gene Tools Inc)
90
Gene Tools Inc sense control morpholino oligonucleotide (co-mo) composed of base sequence 5′-ccagaatgctttccaaactaatcca-3′
Clec14a and <t>C1qr</t> have a partially redundant function during angiogenic sprouting. Kdrl: GFP expression in the trunk region imaged by fluorescent microscopy at 28 hpf ( a - d ), 48 hpf ( e - h ) and 72 hpf ( i - l ). a , e , i Wild-type control embryos; b , f , j clec14a−/− mutants; c , g , k Wild-type embryos injected with 10 ng of c1qr MO; d , h , l clec14a−/− mutant embryos injected with 10 ng of c1qr MO. Note the delayed intersegmental vessel sprouting in clec14a mutants ( b ) and c1qr MO embryos ( c ) at 24 hpf (arrowheads). Partial sprouts (arrowheads) and abnormal vascular connections (arrows) are apparent in the clec14a−/−; c1qr MO embryos ( d , h , l ). m Percentage of embryos with vascular defects. ** p < 0.01; *** p < 0.001; NS, no significance, Fisher’s exact test. Data were combined from 3 independent experiments. Error bars show standard error. n Distribution of different types of phenotypes in embryos at 48 hpf. Data were combined from two independent experiments
Sense Control Morpholino Oligonucleotide (Co Mo) Composed Of Base Sequence 5′ Ccagaatgctttccaaactaatcca 3′, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sense control morpholino oligonucleotide (co-mo) composed of base sequence 5′-ccagaatgctttccaaactaatcca-3′/product/Gene Tools Inc
Average 90 stars, based on 1 article reviews
sense control morpholino oligonucleotide (co-mo) composed of base sequence 5′-ccagaatgctttccaaactaatcca-3′ - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


Clec14a and C1qr have a partially redundant function during angiogenic sprouting. Kdrl: GFP expression in the trunk region imaged by fluorescent microscopy at 28 hpf ( a - d ), 48 hpf ( e - h ) and 72 hpf ( i - l ). a , e , i Wild-type control embryos; b , f , j clec14a−/− mutants; c , g , k Wild-type embryos injected with 10 ng of c1qr MO; d , h , l clec14a−/− mutant embryos injected with 10 ng of c1qr MO. Note the delayed intersegmental vessel sprouting in clec14a mutants ( b ) and c1qr MO embryos ( c ) at 24 hpf (arrowheads). Partial sprouts (arrowheads) and abnormal vascular connections (arrows) are apparent in the clec14a−/−; c1qr MO embryos ( d , h , l ). m Percentage of embryos with vascular defects. ** p < 0.01; *** p < 0.001; NS, no significance, Fisher’s exact test. Data were combined from 3 independent experiments. Error bars show standard error. n Distribution of different types of phenotypes in embryos at 48 hpf. Data were combined from two independent experiments

Journal: BMC Developmental Biology

Article Title: Clec14a genetically interacts with Etv2 and Vegf signaling during vasculogenesis and angiogenesis in zebrafish

doi: 10.1186/s12861-019-0188-6

Figure Lengend Snippet: Clec14a and C1qr have a partially redundant function during angiogenic sprouting. Kdrl: GFP expression in the trunk region imaged by fluorescent microscopy at 28 hpf ( a - d ), 48 hpf ( e - h ) and 72 hpf ( i - l ). a , e , i Wild-type control embryos; b , f , j clec14a−/− mutants; c , g , k Wild-type embryos injected with 10 ng of c1qr MO; d , h , l clec14a−/− mutant embryos injected with 10 ng of c1qr MO. Note the delayed intersegmental vessel sprouting in clec14a mutants ( b ) and c1qr MO embryos ( c ) at 24 hpf (arrowheads). Partial sprouts (arrowheads) and abnormal vascular connections (arrows) are apparent in the clec14a−/−; c1qr MO embryos ( d , h , l ). m Percentage of embryos with vascular defects. ** p < 0.01; *** p < 0.001; NS, no significance, Fisher’s exact test. Data were combined from 3 independent experiments. Error bars show standard error. n Distribution of different types of phenotypes in embryos at 48 hpf. Data were combined from two independent experiments

Article Snippet: A translation-blocking c1qr MO (GTCACTCTCATACTACTCGCTTTAG, Gene-Tools Inc), a 5-base c1qr mismatch MO (GTCAgTCTgATAgTACTCggTTTAG), a standard control MO (CCTCTTACCTCAGTTACAATTTATA, Gene-Tools Inc), a previously reported vegfaa MO (GTATCAAATAAACAACCAAGTTCAT) [ ] and etv2 MO2 (CACTGAGTCCTTATTTCACTATATC) [ ] were used for experiments.

Techniques: Expressing, Microscopy, Injection, Mutagenesis

Analysis of vascular marker expression by in situ hybridization at 24 hpf in clec14a−/− embryos injected with 10 ng of c1qr MO. a - d kdrl, e - h fli1a, i - l cdh5, m - p arterial marker cldn5b, q - t venous marker flt4 expression. Note the strong inhibition of angiogenic sprouting in the double clec14a−/− ; c1qr MO embryos (arrowheads). Only weak or partial inhibition of sprouting is observed in clec14a−/− or c1qr MO embryos. u Percentage of embryos with defects in ISV sprouting is greatly increased among c1qr MO; clec14a−/− embryos compared to c1qr MO or clec14a−/− embryos. n refers to the number of embryos analyzed for each marker. * p < 0.05; ** p < 0.01; *** p < 0.001; NS, no significance, Fisher’s exact test. Data were combined from two independent experiments. Error bars show standard error

Journal: BMC Developmental Biology

Article Title: Clec14a genetically interacts with Etv2 and Vegf signaling during vasculogenesis and angiogenesis in zebrafish

doi: 10.1186/s12861-019-0188-6

Figure Lengend Snippet: Analysis of vascular marker expression by in situ hybridization at 24 hpf in clec14a−/− embryos injected with 10 ng of c1qr MO. a - d kdrl, e - h fli1a, i - l cdh5, m - p arterial marker cldn5b, q - t venous marker flt4 expression. Note the strong inhibition of angiogenic sprouting in the double clec14a−/− ; c1qr MO embryos (arrowheads). Only weak or partial inhibition of sprouting is observed in clec14a−/− or c1qr MO embryos. u Percentage of embryos with defects in ISV sprouting is greatly increased among c1qr MO; clec14a−/− embryos compared to c1qr MO or clec14a−/− embryos. n refers to the number of embryos analyzed for each marker. * p < 0.05; ** p < 0.01; *** p < 0.001; NS, no significance, Fisher’s exact test. Data were combined from two independent experiments. Error bars show standard error

Article Snippet: A translation-blocking c1qr MO (GTCACTCTCATACTACTCGCTTTAG, Gene-Tools Inc), a 5-base c1qr mismatch MO (GTCAgTCTgATAgTACTCggTTTAG), a standard control MO (CCTCTTACCTCAGTTACAATTTATA, Gene-Tools Inc), a previously reported vegfaa MO (GTATCAAATAAACAACCAAGTTCAT) [ ] and etv2 MO2 (CACTGAGTCCTTATTTCACTATATC) [ ] were used for experiments.

Techniques: Marker, Expressing, In Situ Hybridization, Injection, Inhibition